Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 RESOLUCIÓN OIV-OENO HERRAMIENTAS DE BIOLOGÍA MOLECULAR PARA LA IDENTIFICACIÓN DE BACTERIAS LÁCTICAS DE LA UVA Y DEL VINO LA ASAMBLEA GENERAL VISTO el artículo 2 párrafo 2 iv, del acuerdo del 3 de abril de 2001 por el que se crea la Organización Internacional de la Viña y el Vino, A PROPUESTA del grupo de expertos Microbiología, DECIDE adoptar las siguientes herramientas de biología molecular para la identificación de bacterias lácticas de la uva y del vino. HERRAMIENTAS DE BIOLOGÍA MOLECULAR PARA LA IDENTIFICACIÓN DE BACTERIAS LÁCTICAS DE LA UVA Y DEL VINO Generalidades: En las últimas décadas se han desarrollado diferentes métodos moleculares para identificar bacterias lácticas (BAL) de interés enológico con el objeto de reducir el tiempo de análisis que normalmente se requiere para realizar ensayos fenotípicos. Además, como los métodos moleculares no se ven influidos por las condiciones fisiológicas ni ambientales, los resultados de identificación son más fiables. Se pueden usar para identificar bacterias lácticas en el mosto y en las diferentes etapas de la vinificación, del envejecimiento y de la conservación del vino. Entre las herramientas encontramos métodos dependientes e independientes del cultivo. Los métodos moleculares permiten identificar a nivel de especie y de cepa. Además, las cepas bacterianas se pueden diferenciar entre sí e incluso, se pueden detectar las cepas portadoras de genes específicos, sea cual sea la especie. La tabla resume los principales usos de los métodos moleculares para identificar las bacterias lácticas de la uva y del vino. 1

2 IDENTIFICACIÓN A NIVEL DE ESPECIE IDENTIFICACIÓN A NIVEL DE CEPA FUNCIÓN ESPECÍFICA MÉTODOS DEPENDIENTES DE CULTIVO (aislamiento previo de las bacterias en placas y cultivo) Hibridación (1): "dot-blot" y sobre colonias. Hibridación (2): "dot-blot", sobre colonias, in situ ("FISH") y microscopía de fluorescencia Métodos basados en la PCR: -amplificación de una región de consenso y secuenciación (3) -PCR específica de la especie (4) -Análisis (RFLP) o ARDRA: amplificación y restricción (6) Métodos basados en la PCR: -RAPD: amplificación aleatoria (PFGE): restricción del ADN genómico mediante enzimas "cortadoras" raras y electroforesis en gel de campo pulsante Métodos basados en la PCR: PCR específica (5) MÉTODOS INDEPENDIENTES DEL CULTIVO (ANÁLISIS DIRECTO DE LA MUESTRA) 1 Búsqueda de una especie o de una función dada Hibridación in situ y microscopía con fluorescencia (FISH) (1) PCR (4) Hibridación (2): in situ ("FISH") PCR (5) 2 Identificación de bacterias sin a priori (PCR-DGGE) y secuenciación (6) (1) Sonda específica de la especie (2) La sonda es un gen, un fragmento de gen o una región que codifica una proteína concreta (enzima) (3) Los cebadores amplifican la región de consenso (ADNr 16S y rpob) (4) Los cebadores son específicos de la especie (5) Los cebadores son específicos de un gen o una región que codifica una proteína concreta (enzima) 2

3 (6) Los amplicones de consenso se separan mediante electroforesis en gel desnaturalizante, después se secuencian. La secuencia es propia de cada especie. 3

4 MÉTODOS DEPENDIENTES DEL CULTIVO 1. Introducción Los métodos de análisis se aplican a cultivos puros o colonias cuyo ADN se pueda extraer o estar accesible para sondas. 1.1 Aislamiento de clones y obtención de cultivos puros La mayoría de las bacterias que se desarrollan en el vino pueden aislarse mediante técnicas microbiológicas tradicionales, como el cultivo en medios de agar nutritivos apropiados. Según su concentración, es necesaria una dilución en serie de la muestra en agua fisiológica estéril (0,9% NaCl) antes de realizar el cultivo en un medio agar nutritivo específico. Las bacterias lácticas de la uva y el vino crecen sobre el medio descrito para su recuento (CII/MICRO/01/206). La población bacteriana obtenida se puede identificar a continuación. Los clones se aíslan en la placa y se vuelven a cultivar en el mismo medio líquido, o bien se repite el cultivo en placa para purificar la cepa aislada. A continuación se devuelve al cultivo líquido un solo clon para proporcionar la biomasa de cultivo puro que se va a analizar. En algunos casos la colonia se usa directamente para la identificación, por ejemplo, para PCR (reacción en cadena de la polimerasa). Todas las colonias crecidas sobre la superficie de la placa de Petri son analizadas en la hibridación. 1.2 Extracción de ADN El ADN se tiene que extraer de la biomasa obtenida después del cultivo. Este pasa a ser accesible por lisis celular in situ para la hibridación en colonias o para el análisis con microscopio ("FISH"). Para el método directo de PCR de colonias no hay que hacer una extracción; el ADN se vuelve disponible para la amplificación durante el primer ciclo de aumento de temperatura del protocolo de amplificación. 2. A nivel de la especie o para una función específica 2.1 Hibridación [ en mancha (dot-blot) sobre colonias] con sondas de ADN específicas de una especie o de una región del genoma Campo de aplicación: Identificación de bacterias lácticas del vino a nivel de la especie o de una función concreta (actividad enzimática). El principio común de los métodos de hibridación ADN-ADN es que los fragmentos de ácidos nucleicos complementarios se pueden hibridar en condiciones específicas, dependiendo principalmente de la temperatura y de la fuerza iónica del tampón. Tras la desnaturalización a cadena única, el ADN extraído de las bacterias que se van a identificar, denominado "diana", puede reasociarse en condiciones de hibridación con una cadena única conocida de ADN, denominada "sonda", si las secuencias son idénticas o lo suficientemente parecidas. Es por eso que la elección de la sonda es fundamental, y determinará el nivel taxonómico del estudio. La sonda puede ser todo o parte del 4

5 genoma que aporte la especificidad. En la mayoría de los casos, se usan las sondas del ADNr 16S para identificar la especie. Pero a veces se produce una "hibridación cruzada" y conviene encontrar otras secuencias. El mismo principio se aplica a la identificación de bacterias portadoras de genes específicos o regiones implicadas en una función determinada. Las sondas son los genes, o partes de genes, que codifican para las proteínas correspondientes. La aplicación más conocida es la identificación de bacterias causantes de alteraciones. Existen varios procesos de hibridación en función de la aplicación (i) Métodos que utilizan el ADN extraído de un cultivo de la cepa a identificar. El ADN diana extraído del cultivo que se quiere identificar, se deposita y se fija en una membrana. La sonda de ADN, compuesta por un ADN de referencia marcado, se pone en contacto con la membrana situada en las condiciones de temperatura de hibridación. Después de la reacción de hibridación y de los lavados, cuyo objetivo es el de eliminar cualquier resto de sonda no hibridizada, la membrana se trata para revelar los híbridos (ADN diana/adn sonda). (ii) Métodos aplicados sobre las células enteras: sobre colonias. La membrana se pone en contacto en la superficie nutritiva de agar con las colonias que se han desarrollado sobre el medio de cultivo y, a continuación, se retira. En ella quedan retenidas las colonias, que han sido transferidas por simple contacto. La membrana se trata a continuación para la lisis de las células (de manera que se pueda acceder al ADN) y para la hibridación con la sonda. Después de la hibridación, obtenemos una imagen de la placa, perteneciendo las colonias visibles a la misma especie que la sonda de referencia. Gracias a la utilización de varias sondas de ADN específicas, esta técnica permite identificar las especies de bacterias lácticas de la muestra después de sucesivas hibridaciones y deshibridaciones de la misma membrana. Lonvaud-Funel, A., Fremaux, C., Biteau, N., Joyeux A. (1991a). Speciation of lactic acid bacteria from wines by hybridisation with DNA probes. Food Microbiol., 8, Lonvaud-Funel, A., Joyeux, A., Ledoux, O. (1991b). Specific enumeration of lactic acid bacteria in fermenting grape must and wine by hybridization with non isotopic DNA probes. J. Appl. Bacteriol., 71, Sohier, D., Coulon, J., Lonvaud-Funel, A Molecular identification of Lactobacillus hilgardii and genetic relatedness with Lactobacillus brevis. Int. J. Syst. Bacteriol., 49, (iii) Polimorfismo de restricción (RFLP) ribotipado: Los fragmentos de restricción que se han obtenido tras la digestión del ADN total extraído del cultivo se separan por electroforesis en geles de agarosa y se transfieren a membranas de nailon o de nitrocelulosa para su hibridación con una sonda de ADN ribosómico (Southern) previamente marcada. Después de la hibridación y revelado, el perfil pasa a ser la imagen de los fragmentos que se han generado por restricción, en toda la longitud de la región genómica complementaria a la sonda. El uso de genes ribosómicos para la sonda (u otros genes) hace posible que se identifique la cepa de una especie o subespecie, comparando la longitud de los 5

6 fragmentos en la región ribosómica (ribotipificación/ribotipado) (o en otra región específica del genoma). 2.2 Métodos basados en la PCR (reacción en cadena de la polimerasa): Campo de aplicación: Identificación a nivel de especie de bacterias lácticas previamente aisladas del mosto y del vino mediante cultivo en placa. El método PCR se puede adaptar a varios niveles de identificación (género, especie o cepa) en función de la elección de los cebadores (secuencia corta de oligonucleótidos). El principio es el siguiente: el cebador busca la región complementaria para emparejarse en el molde de ADN que se está analizando. La polimerización opera a partir del extremo del cebador copiando la cadena de ADN matriz numerosísimas veces, lo que conduce al amplificado Amplificación de las regiones de consenso y secuenciación: subunidad del ARN ribosómico 16S y gen rpob El método básico es la secuenciación del amplificado del gen que codifica el ARNr 16S. Este enfoque se basa en la presencia obligatoria del ARNr en las bacterias. La secuencia de nucleótidos de este gen permite la clasificación filogenética y la identificación de aislados desconocidos, dado que la base de datos existente para este gen es la más amplia de los genes bacterianos. La secuencia de nucleótidos de la región comprendida entre los genes que codifican para el ARNr 16S y 23S, denominada ITS, se puede usar para la identificación, pero su secuencia está menos conservada. En este caso, la PCR usa cebadores correspondientes a las regiones conservadas universales dentro de los genes que codifican el ARNr 16S y 23S, de una y otra parte del ITS. Otra secuencia interesante es rpob, que codifica una subunidad de la ARN-polimerasa. Se ha visto que es más apta para la identificación (por lo menos por lo que se sabe hasta ahora). En efecto sólo hay una copia de este gen en las bacterias, aunque hay varias copias del operón ribosómico, cuya secuencia pude variar dentro de la misma especie. No obstante, su uso es más raro porque la base de datos es más reciente y está relativamente peor documentada. No obstante, se ha establecido una base de datos para las principales especies de bacterias lácticas del vino y se han desarrollado cebadores para las bacterias lácticas enológicas. Protocolo general: Este método requiere la extracción del ADN del cultivo puro que se ha de identificar. El ADN extraído sirve de molde en la reacción de PCR. Tras la separación por electroforesis, los amplificados se purifican con los kits correspondientes y a continuación se secuencian. Las secuencias resultantes de los genes que codifican el ARNr 16S o rpob se comparan con las que aparecen en las bases de datos disponibles. Du Plessis, E.M.; Dicks L.M.T., Pretorius I.S., Lambrechts M.G., & du Toit M. (2004). Identification of lactic acid bacteria isolated from South African brandy base wines. Int. J Food Microbiol. 91; Sato, H., Yanagida, F., Shinohara, T., Suzuki, M., Suzuki, K., Yokotsuka, K. (2001). Intraspecific diversity Oenococcus oeni. FEMS Microbiol. Lett. 202,

7 Renouf, V., O. Claisse, and A. Lonvaud-Funel rpob gene: A target for identification of LAB cocci by PCR-DGGE and melting curves analyses in real time PCR. J. Microbiol. Met. 67: PCR específica de la especie La técnica PCR es apta para la identificación directa de especies porque se puede encontrar cebadores específicos que sólo amplifican en una especie dada. Se han descrito diversas parejas de cebadores para la identificación de varias especies de bacterias lácticas. En enología es imprescindible identificar la especie Oenococcus oeni. Los cebadores se basan en regiones de la enzima maloláctica que difieren según la especie. Zapparoli G, Torriani S, Pesente P, Dellaglio F., Design and evaluation of malolactic enzyme gene targeted primers for rapid identification and detection of Oenococcus oeni in wine. Lett Appl Microbiol. 27: Polimorfismo de longitud de los fragmentos de restricción (RFLP) Campo de aplicación: Identificación de especies de bacterias lácticas del vino. Basándose en el mismo principio que el ribotipado (ver apartado iii), la amplificación por PCR de la región ribosómica (u otra región), después de la restricción del amplificado mediante enzimas adecuadas da la misma información. Pero este método es mucho más fácil y rápido que la restricción seguida de la hibridación. La restricción del gen que codifica el ARNr 16S o del gen que codifica el rpob con una endonucleasa de restricción adecuada y la separación de fragmentos mediante electroforesis con gel de agarosa da como resultado una estructura característica de fragmentos de ADN específico de una especie particular. Resultados: Discriminación de cepas O. oeni respecto a otras especies mediante análisis RFLP del ARNr 16S. Identificación de especies de bacterias lácticas aplicando la técnica RFLP al gen rpob. Claisse, O., V. Renouf, and A. Lonvaud-Funel Differentiation of wine lactic acid bacteria species based on RFLP analysis of a partial sequence of rpob gene. Journal of microbiological methods 69: Zavaleta, A.I.; Martínez-Murcia, A.J.; Rodríguez-Valera, F. 16S-23S rdna intergenic sequences indicate that Leuconostoc oenos is phylognetically homogeneous. Microbiology, 1996, 142, Sato, H.; Yanagida, F.; Shinohara, T.; Yokosutka, K. Restriction fragment length polymorphism analysis of 16S rrna genes in lactic acid bacteria isolated from red wines. J. Biosc. Bioengin. 2000, 3,

8 3. Identificación a nivel de cepa: Campo de aplicación: Identificación de bacterias lácticas del vino a nivel de cepa. 3.1 Métodos basados en la PCR: Amplificación aleatoria del ADN (RAPD) La RAPD se basa en la PCR con cebadores de secuencias arbitrarias capaces de hibridarse en diferentes puntos del genoma. Se usa un solo cebador arbitrario de unos 10 nucleótidos de largo para amplificar segmentos aleatorios de ADN genómico, y genera un perfil característico compuesto de fragmentos de ADN cortos de diferentes longitudes. También se puede usar una combinación de dos o más oligonucleótidos (RAPD múltiple) en una sola PCR para generar perfiles RAPD más confiables para tipificar cepas. Los perfiles RAPD son característicos de las cepas, su fiabilidad y su poder de discriminación dependen de las secuencias de los cebadores. Resultados: Este método permite obtener una huella genética característica de la cepa. Esta se puede usar para controlar la correcta implantación de fermentos malolácticos durante la vinificación. El mayor inconveniente es la falta de repetibilidad y de reproducibilidad. Bartowsky, E.J., McCarthy, J.M., Henscheke, P.A. (2003). Differentiation of Australian wine isolates of Oenococcus oeni using random amplified polymorphic DNA (RAPD). Aus. J. of Grape and Wine Res., 9, Du Plessis, E.M., Dicks, L.M.T. (1995). Evaluation of random amplified polymorphic DNA (RAPD)-PCR as a method to differentiate Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus amylovorans, Lactobacillus gallinarum, Lactobacillus gasseri, and Lactobacillus johnsonii. Curr. Microbiol., 31, Reguant, C., Bordons, A. (2003). Typification of Oenococcus oeni strains by multiplex RAPD-PCR and study of population dynamics during malolactic fermentation. J. Appl. Microbiol., 95, Rodas, A.M., Ferrer, S., Pardo, I. (2005). Polyphasic study of wine Lactobacillus strains: taxonomic implications. Int. J. Sys. Evol. Microbiol., 55, Zavaleta, A.I., Martinez-Murcia, A.J., Rodriguez-Valera, F. (1997). Intraspecific genetic diversity of Oenococcus oeni as derived from DNA fingerprinting and sequence analyses. Appl. Environ. Microbiol., 63(4), Análisis del perfil de restricción del genoma mediante electroforesis en gel de campo pulsante (PFGE) El ADN genómico se digiere con enzimas de restricción con pocos sitios de corte. La totalidad del genoma se fragmenta en una serie de fragmentos, que permiten una lectura fácil y una diferenciación clara entre las cepas. Las células bacterianas de cultivos frescos se recuperan mediante centrifugación y se inmovilizan en bloques de agarosa. La lisis de la célula y la restricción del ADN genómico se realizan en los bloques para que el ADN sea fragmentado únicamente de forma específica por la enzima y no de forma aleatoria por efectos mecánicos. Los bloques de gel se depositan en el gel de agarosa y los 8

9 fragmentos separados por electroforesis PFGE. Los fragmentos, que son de gran longitud ya que son generados por las enzimas de escasos cortes, se separan bajo el efecto del campo eléctrico pulsante. Las endonucleasas de restricción ApaI y NotI son las más utilizadas y adaptadas para revelar el polimorfismo entre cepas de O. oeni. También se han usado las enzimas SfiI y SmaI para diferenciar el nivel intraespecífico de diversas especies de Lactobacillus del vino. Resultados: Se trata de una técnica muy segura para la identificación a nivel de cepa. Es reproducible y, tras una primera restricción, una segunda enzima podrá disipar la duda, de ser necesario. Esta se puede usar para controlar la pureza de los cultivos durante la producción de fermentos. Es la más apropiada para evaluar la supervivencia y el desarrollo de los fermentos tras la inoculación para la fermentación maloláctica. La principal desventaja estriba en que esta técnica requiere mucho tiempo debido a la etapa preliminar de cultivo necesaria antes de la restricción; además, requiere un equipo especial que resulta bastante oneroso. Gindreau, E., Joyeux, A., De Revel, G., Claisse, O., Lonvaud-Funel, A. (1997). Evaluation de l établissement des levains malolactiques au sein de la microflore bactérienne indigene. J. Int. Sci. Vigne Vin 31, Pardo I., Rodas A.; Ferrer S. (1998). Study on populations dynamics of Oenococcus oeni in wine by using RFLP-PFGE. Les entretiens scientifiques Lallemand nº 6. pp Rodas, A.M., Ferrer, S., Pardo, I. (2005). Polyphasic study of wine Lactobacillus strains: taxonomic implications. Int. J. Sys. Evol. Microbiol., 55, Zapparoli, G., Reguant, C., Bordons, A., Torrioni, S., Dellaglio, F. (2000). Genomic DNA fingerprinting of Oenococcus oeni strains by pulsed-field electrophoresis and randomly amplified polymorphic DNA-PCR. Current Microbiol., 40, MÉTODOS INDEPENDIENTES DEL CULTIVO: 1. Introducción Los métodos independientes del cultivo sirven para determinar la diversidad de poblaciones bacterianas que se producen durante la vinificación, sin necesidad de aislar ni cultivar. También permiten detectar las eventuales células bacterianas viables pero no cultivables (VNC). Estas técnicas conllevan la intervención de: - PCR: después de la extracción del ADN total de muestras de zumo de uva o de vino, se produce la amplificación mediante la técnica PCR (reacción en cadena de la polimerasa) con cebadores universales que amplifican el ADN 16S, o específicos de la especie o de la cepa. - Hibridación in situ: uso de sondas específicas para hibridar directamente en láminas el ADN de las bacterias de la muestra. La observación hace referencia a la microscopía. 9

10 1.1 Extracción de ADN de una muestra de zumo de uva o de vino Se han desarrollado métodos eficaces de extracción y amplificación de ADN que han sido aplicados para trabajar a partir de muestras de mostos y vinos. Se han descrito varios protocolos de extracción de ADN (Baleiras-Couto y Eiras-Dias, 2005; Jara et al., 2008; Pinzani et al., 2004, Savazzini y Martinelli, 2006, Marques et al. 2010). Por lo general se usan varios kits comerciales según las recomendaciones del fabricante o siguiendo los protocolos modificados. Renouf et al. (2006) describieron el siguiente protocolo de extracción de ADN que se adaptó a muestras de vino: 10 ml de vino se centrifugan a g durante 10 minutos, a temperatura ambiente. El sedimento se lava en 1ml de solución tampón Tris 10mM y EDTA 1mM (TE). Después de una segunda centrifugación ( g durante 5 minutos) se retira el sobrenadante y el sedimento se vuelve a suspender en 300 µl de 0,5 mm EDTA ph 8. Se añaden 300 µl de perlas de vidrio ( 0,1 mm) y se mezclan las muestras a velocidad máxima durante 10 minutos. A continuación se añaden 300 µl de solución de lisis y 200 µl de solución de precipitado proteico y se mezclan durante 20 segundos. Los fragmentos celulares precipitan manteniendo el tubo en hielo durante 5 minutos. Después de otra centrifugación (a g durante 3 minutos), el sobrenadante que contiene el ADN se pasa a un nuevo tubo de microcentrifugación y se añaden 60 µl de una solución de polivinilpirrolidona (PVP) al 10%. Al agitar en un vórtex a alta velocidad durante 10 s precipitan los polifenoles del vino que inhiben la reacción de amplificación. Después de una centrifugación (a g durante 2 minutos), se pasa el sobrenadante a un tubo de microcentrifugación de 1,5 ml con 300 µl de isopropanol a temperatura ambiente. El contenido del tubo se mezcla cuidadosamente invirtiéndolo hasta que aparezca una masa visible de ADN. Después de la centrifugación (a g durante 15 minutos), se añaden al sedimento 300 µl de etanol al 70% y a temperatura ambiente antes de una última fase de la centrifugación (a g durante 2 minutos). El etanol se aspira meticulosamente y se seca el tubo. En total se usan 50 µl de agua para preparación inyectable (PPI) con 1 µl de RNasa para rehidratar el ADN durante una noche a 4ºC. Después de la rehidratación, el ADN se conserva a -20 C. Baleiras-Couto M.M., Eiras-Dias J.E. (2006). Detection and identification of grape varieties in must and wine using nuclear and chloroplast microsatellite markers. Analytica Chimica Acta 563: Jara C., Mateo E., Guillamón J.M., Torija M.J., Mas A. (2008) Analysis of several methods for the extraction of high quality DNA from acetic acid bacteria in wine and vinegar for characterization by PCR-based methods. Int. J. Food Microb., 128: Marques A.P., Zé-Zé L., San-Romão M.V., Tenreiro,R. (2010) A novel method for identification of Oenococcus oeni and its specific detection in wine. Int. J. Food Microb., 142: Pinzani P., Bonciani L., Pazzagli M., Orlando C., Guerrini S. and Granchi L.(2004) Rapid detection of Oenococcus oeni in wine by real-time quantitative PCR. Lett. Appl. Microb., 38:

11 Savazzini F., Martinelli L. (2006) DNA analysis in wines: Development of methods for enhanced extraction and real-time polymerase chain reaction quantification Analytica Chimica Acta, 563: Identificación de la especie 2.1 Reacción en cadena de la polimerasa, electroforesis en geles de gradiente desnaturalizante (PCR y DGGE) y secuenciación Campo de aplicación: Identificación de bacterias lácticas del vino a nivel de especie, en una población mixta La técnica PCR-DGGE se aplica después de la extracción de ADN de la muestra. Esta consiste en la amplificación de las regiones hipervariables de genes codificantes del ARNr 16S u otros genes como el rpob (codificante de la subunidad de la ARN-polimerasa) rodeados por regiones de consenso. Los amplificados de ADN, todos idénticos en tamaño, pero diferentes en su secuencia si se trata de diferentes especies, se separan mediante electroforesis en un gel de poliacrilamida con un gradiente de agentes desnaturalizantes (por lo general urea y formamida). Los fragmentos de ADN bicatenario migran a través del gel hasta que se desnaturalizan por las condiciones químicas, comportando una desaceleración de su migración y finalmente su inmovilización. No obstante, los fragmentos no se llegan a desnaturalizar del todo debido a que se forma un GC clamp gracias a la utilización de un cebador de PCR con extremo 5' rico en GC. La posición del gel en la que se desnaturaliza el fragmento de ADN bicatenario y se convierte en monocatenario depende de la secuencia de nucleótidos y del contenido de GC (%) del fragmento. Las diferentes secuencias tienen campos de fusión y, como consecuencia, también a diferentes posiciones de detención en el gel. Los amplificados de ADN de bacterias de diferentes especies se separan por su distancia de migración en el gel. La identificación final de cada especie se obtiene ya sea localizando la distancia de migración con respecto a un ADN de referencia de la especie o purificando y secuenciando el ADN de la banda extraído del gel y comparándolo con los bancos de datos disponibles (Gen Bank, Esta técnica se ha empleado con éxito para identificar varias especies de bacterias lácticas del vino en una mezcla compleja. Al principio se usaron regiones de ADNr 16S como ADN diana (López et al., 2003), pero más recientemente ha quedado demostrado que el gen doméstico rpob, codificante de la subunidad beta de la ARN-polimerasa, es una mejor diana para la diferenciación de especies mediante análisis directo PCR-DGGE que el gen ARNr 16S (Rantsiou et al. 2004; Renouf et al. 2006; Renouf et al. 2007, Spano et al. 2007). López I., Ruiz-Larrea F., Cocolin L., Orr E., Phister T., Marshall M., VanderGheynst J., and Mills D.A. (2003) Design and Evaluation of PCR Primers for Analysis of Bacterial 11

12 Populations in Wine by Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol Rantsiou, K., Comi, G., Cocolin, L., The rpob gene as a target for PCR-DGGE analysis to follow lactic acid bacteria population dynamics during food fermentations. Food Microbiol. 21, Renouf V., Claisse O., Miot-Sertier C.,.Lonvaud-Funel A (2006) Lactic acid bacteria evolution during winemaking:use of rpob gene as a target for PCR-DGGE analysis. Food Microbiol. 23: Renouf V., Strehaiano P. and Lonvaud-Funel A. (2007) Yeast and bacteria analysis of grape, wine and cellar equipments by PCR-DGGE. J. Int. Sci. Vigne Vin, 41: Spano G., Lonvaud-Funel A., Claisse O., Massa S. (2007) In Vivo PCR-DGGE Analysis of Lactobacillus plantarum and Oenococcus oeni Populations in Red Wine. Current Cur. Microbiol., 54: Reacción en cadena de la polimerasa (PCR) con cebadores específicos de cada especie Campo de aplicación: Investigación de especies de bacterias lácticas mezcladas en una muestra de vino o mosto. El principio general consiste en que los cebadores específicos de una especie hibridan en el ADN matriz de la mezcla de ADN extraído del vino o del mosto si encuentran las secuencias complementarias. Su hibridación provoca la reacción de amplificación. Sólo se amplificará el ADN de la especie concernida, por la elección de cebadores, si está presente esta especie. Procedimiento: La investigación de la presencia de Oenococcus oeni es posible porque se han desarrollado cebadores específicos para esta especie. Después de extraer el ADN de las muestras de zumo de uva o de vino se realizan las reacciones de PCR según las condiciones descritas en los protocolos específicos. Zapparoli et al. (1998), y Bartowsky y Henschke (1999) desarrollaron condiciones de PCR para identificar O. oeni con cebadores específicos para el gen de la enzima maloláctica o el gen ARNr 16S. Zapparoli G, Torriani S, Pesente P, Dellaglio F., Design and evaluation of malolactic enzyme gene targeted primers for rapid identification and detection of Oenococcus oeni in wine. Lett Appl Microbiol. 27: Bartowsky E.J., Henscke P.A Use of a polymerase chain reactionfor specific detection of the malolactic fermentation bacterium Oenococcus oeni (formerly Leuconostoc oenos) in grape juice and wine samples. Austr. J. Grape Wine Res. 5:

13 2.3 Detección de cepas particulares de bacterias lácticas caracterizadas por la presencia de un gen que codifica una función especial: detección de bacterias alterantes El principio del protocolo es el mismo que para la investigación de una especie pero los cebadores son secuencias deducidas de genes que determinan las funciones de alteración: producción de aminas biógenas (ver OENO-MICRO ), amargor por hidroxipropionaldehído/acroleína (Claisse y Lonvaud-Funel, 2001) y viscosidad (Gindreau et al., 2001). Claisse, O., y A. Lonvaud-Funel Primers and a specific DNA probe for detecting lactic acid bacteria producing 3-hydroxypropionaldehyde from glycerol in spoiled ciders. J Food Prot 64: Gindreau, E., E. Walling, y A. Lonvaud-Funel Direct polymerase chain reaction detection of ropy Pediococcus damnosus strains in wine. J Appl Microbiol 90: Identificación de una especie bacteriana en una población mixta sin extracción de ADN 3.1 Hibridación in situ: Técnica de hibridación in situ con fluorescencia (FISH) Se basa en el diseño de sondas específicas de una especie marcadas con una etiqueta fluorescente. El ARN ribosómico es a menudo la diana de estas sondas. En un primer paso se permeabilizan las células bacterianas, permitiendo la penetración de la sonda a través de la pared celular y su llegada hasta el ARN. La sonda hibrida si la secuencia complementaria se encuentra en el ARN 16S del ribosoma. Por lo tanto, el fluorocromo se fija en el ribosoma de células cuya especie se corresponde con la sonda durante este paso. La observación se lleva a cabo con un microscopio de epifluorescencia. Se podrá detectar, contar e identificar simultáneamente diferentes tipos de microorganismos en una muestra si se utilizan diversas sondas con fluorocromos de diferente color. Una de las principales ventajas de este método es que es muy rápido, porque no requiere el cultivo de la muestra. Su principal inconveniente es que tiene poca sensibilidad limitada por la observación microscópica. Este método se puede adaptar a la detección de cepas específicas eligiendo una sonda de ADN que hibride con un gen o cualquier otra región del genoma. Sohier, D. Lonvaud- Funel, A. (1998). Rapid and sensitive in situ hybridization method for detecting and identifying lactic acid bacteria in wine. Food Microbiol. 15, Blasco L., Ferrer S.; Pardo I. (2003). Development of specific fluorescent oligonucleotide probes for in situ identification of lactic acid bacteria. FEMS Microbiol. Lett. 225,

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles



Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles


APLICADAS A LA ECOLOGÍA MICROBIANA TÉCNICAS MOLECULARES APLICADAS A LA ECOLOGÍA MICROBIANA Áreas de estudio tradicionales en la Ecología Microbiana: - Estudio de la diversidad microbiana, incluye aislamiento, identificación y cuantificación

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles



Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

ES 2 304 832 A1 C12Q 1/68 (2006.01) OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 304 832

ES 2 304 832 A1 C12Q 1/68 (2006.01) OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 304 832 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 4 832 21 Número de solicitud: 0061 1 Int. Cl.: C12Q 1/68 (06.01) 12 SOLICITUD DE PATENTE A1 22 Fecha de presentación: 13.12.0

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles



Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles



Más detalles



Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Técnicas moleculares para el diagnóstico de microorganismos fitopatógenos

Técnicas moleculares para el diagnóstico de microorganismos fitopatógenos Técnicas moleculares para el diagnóstico de microorganismos fitopatógenos Dra. Ing. Agr. Sandra Alaniz Unidad de Fitopatología setiembre de 2015 Unidades taxonómicas Dominio Orden Familia Género Especie

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles



Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles


TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Aislamiento, análisis y manipulación de ácidos nucleicos Generación de moléculas de DNA recombinante Ingeniería Genética AISLAMIENTO

Más detalles


3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles



Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles


AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles



Más detalles



Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles


OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles



Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles



Más detalles

Tema 12. Estructura genética de las poblaciones. Genética CC.MM.

Tema 12. Estructura genética de las poblaciones. Genética CC.MM. Tema 12. Estructura genética de las poblaciones Genética CC.MM. Contenidos Estructura genética de las poblaciones Cuantificación de la variabilidad genética en las poblaciones Equilibrio Hardy-Weinberg

Más detalles



Más detalles

PROYECTO No.: RM C Dra. M.LL. Palop Herreros (UCLM) Dr. P.M. Izquierdo Cañas (IVICAM)


Más detalles


TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos I. INTRODUCCION Para poder llevar a cabo una fermentación con éxito es imprescindible y obligatorio tener en todas las etapas cultivos libres de contaminantes,

Más detalles


MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles



Más detalles

Extracción de DNA por el Método Adaptado de Drábek.

Extracción de DNA por el Método Adaptado de Drábek. Extracción de DNA por el Método Adaptado de Drábek. El aislamiento de DNA constituye un paso esencial para la realización de estudios de tamizaje genético, análisis de polimorfismos genéticos, estudios

Más detalles

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 Nociones generales sobre Marcadores Moleculares -ADN Analizan directamente la molécula de ADN. Detectan ciertas variaciones

Más detalles

Secretaría de Posgrado del Instituto de Ecología, A.C. Propuesta de Curso

Secretaría de Posgrado del Instituto de Ecología, A.C. Propuesta de Curso Secretaría de Posgrado del Instituto de Ecología, A.C. Propuesta de Curso NOTA: Los puntos en negritas son indispensables en este momento para poder hacer buena difusión de sus cursos y llevar a cabo la

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles



Más detalles

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares.

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. INTRODUCCIÓN La determinación morfológica y morfométrica de nematodos fitopatógenos en los laboratorios

Más detalles

PCR gen 16S ARNr bacteriano

PCR gen 16S ARNr bacteriano PCR gen 16S ARNr bacteriano Ref. PCR16S 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y la práctica de la Reacción en Cadena de la Polimerasa

Más detalles