Julián Sanz. NGS, paneles de genes y otros métodos para clasificar pacientes y predecir respuesta..

Transcripción

1 Julián Sanz NGS, paneles de genes y otros métodos para clasificar pacientes y predecir respuesta..

2 Caso 1 Mujer 29a, sin Hª Familiar Masa de 2.5 cm en Mama izquierda PAAF guiada por TAC: Ca ductal invasivo (ER y PR +) Her2- Germline testing BRCA1 y BRCA2 (Illumina): en sangre: - Mastectomía radical: estadio IIIA (pt2pn2 (7/16) M0) QT-RT-tamoxifen y supresión ovárica Recurrencia en hueso a los 2 años y luego en piel e hígado PI3KCA COBAS (sens 1-10%; en primario)(mutations in exons 1, 4, 7, 9 and 20) y SANGER: - 5 ml de cfdna en fase terminal; dpcr rare mutation assays for E542K, E545K, and H1047R (Life Technologies) (sens 0.1%): PIK3CA E545K mut at 53.48% total cfdna Fallece a los 5 años, Autopsia/donación al Biobanco HCSC

3 Case : PIK3CA: Primary, rib and skin: wt, Liver and cfdna: mut E545K PIK3CA Diana terapéutica y factor pronóstico. PIK3CA : mutations in 40% ER + Early stage breast cancer: good prognosis and responsiveness to endocrine therapy Metastatic: resistance? Romero A; Acosta D; Sanz J et al: Trasl Res Dic 2015.

4 Heterogeneidad: Time and therapy Tumor plasticity and molecular adaptive genotype

5 Heterogeneidad -Inter tumores (clasificación morfológica y clasif. molecular) -Intratumoral (en tiempo y espacio) - De la muestra (%células tumorales/ totales)

6 1º.-Elegir muestra -What is the optimal sample? NSCLC the tissue is the issue

7 Muestra adecuada a cada técnica molecular Control de las variables preanalíticas Control histológico. Valoración % tumoral y necrosis Citologías: válidas para estudios genómicos, ojo Biomarcadores IHQ Sensibilidad % células tumorales Nº células IHQ FISH PCR SANGER 30-50% NGS 20% PCR a tiempo REAL 1-10% PCR digital 0.1% Beaming 0.01%

8 2º.- Clasificar. DLL3/Rovalpituzumab IHQ FISH PCR PDL1

9 NGS Preguntas Es mejor que ir gen a gen? Mejor gestión de muestras? Qué método uso? In-house o servicio externo? Detecta Todas las alteraciones moleculares? Papel del patólogo. Es igual de eficaz en biopsia líquida que en tejido? Quién interpreta resultados?

10 NGS: Conceptos ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGA ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGA CGGTGAACGTTATCGACGATCCGATCGAACTGTCAGC GGTGAACGTTATCGACGTTCCGATCGAACTGTCAGCG TGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGC TGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGC TGAACGTTATCGACGTTCCGATCGAACTGTCAGCGGC GTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT TTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT ATCCTGATTCGGTGAACGTTATCGACGATCCGATCGAACTGTCAGCGGCAAGCTGATCGATCGATCGATGCTAGTG reference genome Alineamiento Sensibilidad Coverage (profundidad) TTATCGACGATCCGATCGAACTGTCAGCGGCAAGCT TCGACGATCCGATCGAACTGTCAGCGGCAAGCTGAT ATCCGATCGAACTGTCAGCGGCAAGCTGATCG CGAT TCCGATCGAACTGTCAGCGGCAAGCTGATCG CGATC TCCGATCGAACTGTCAGCGGCAAGCTGATCGATCGA GATCGAACTGTCAGCGGCAAGCTGATCG CGATCGA AACTGTCAGCGGCAAGCTGATCG CGATCGATGCTA TGTCAGCGGCAAGCTGATCGATCGATCGATGCTAG TCAGCGGCAAGCTGATCGATCGATCGATGCTAGTG INDELs 10

11

12 Métodos de NGS Menos ADN Mayor profundidad coverage. Menos tiempo/ complejidad Mayor complejidad para construir librerías Menos falsos+, falsos- Mejor para CNV, deletions, rearrangements?

13 DNA alterations the small stuff the bigger stuff Deletion/Insertion Ej: ALK (patrón atípico) Amplificación HER2 Breast cancer

14 Mujer de 67 años Enero de 2017: Adenocarcinoma de Pulmón estadío IV (múltiples nódulos pulmonares y metástasis óseas). Mutación de EGFR en exon 21 (COBAS). PDL1 60%, ALK-; ROS1-. * Gefitinib enero de 2017, respuesta parcial mantenida TC :,progresión de nódulos pulmonares, derrame pleural derecho de nueva aparición, progresión ósea ( Se administra RT sobre D9) * T790M+ en biopsia líquida inició tratamiento con Osimertinib el 27/07/17 CASO 2 En 2017 July 2017 Sep 2017 Oct 2017 Nov 2017 TC : Adenopatías supraclaviculares mediastínicas prevasculares y subcarinales >derrame pleural derecho respecto al estudio previo. Nódulos bilaterales en LSD. 3 metástasis hepáticas en el LHD. > metástasis óseas 14 * BAG de LOE hepática descarta diferenciación neuroendocrina y confirma origen pulmonar. COBAS: 858+,T790-. Se inicia Cisplatino + Alimta.

15 NEW PLATFORM Applies next-generation sequencing to identify genomic alterations across 315 cancer-related genes known to be drivers of solid tumors plus select introns of 28 genes Designed to analyze and interpret DNA sequence information of 405 genes and RNA sequence (cdna) information of 265 commonly rearranged genes in hematologic malignancies A liquid biopsy Assay for Circulating Tumor DNA, interrogating all known classes of genomic alteration across 62 genes. Provides validated, blood-based profiling when tissue biopsy may not be feasible Microsatellite instability (MSI) + tumor mutational burden (TMB) testing A single solution for simultaneous assessment of MSI and TMB biomarkers previously separate and time- and laborintensive tests. Will provide additional and relevant genomic clues as to which patients may benefit the most from certain immunotherapies An online portal for oncologists to interact with patient sequencing data which allows comparison of contextualized patient information Frampton G, et al. Nature Biotech, 2013, 31, Jie H et al. Blood 2016

16 Process Begins With Expert Pathology Review Can be run on small, routine FFPE samples Each in-bound specimen checked Measurements ( 40 μm tissue) Minimum of 20% is of malignant origin, on 10 unstained slides or in an FFPE block. What if the % tumor is <20%, but the tumor is localized? Rescue it by enriching increase the ratio of malignant cells to normal cells by removing (depleting) the normal tissue Area marked under the microscope (micro) and enriched using a razor blade (macro) cross between micro- and macro-dissection Laurence, J.J., et al, Guidelines for validation of Next-Generation Sequencing_ Based Oncology panels. A Joint Consensus Recommendation of the Association for Molecular pathology and college of American Pathologists. The journal of molecular diagnostics 2017 in press 5 x 5 80% Breast Inflammatory carcinoma

17 Foundation Medicine Report example Patient Information Patient results: - Genomic Alterations Identified - Additional Disease-relevant Genes with No Reportable (Alterations Identified) Therapeutic implications: - Therapies associated with potential clinical benefit (approved in this cancer tumor type and in other tumor types) - Therapies associated with lack of response - Clinical Trials

18

19 Tipos de Control de calidad del ADN Interpretación: A B C D Interna/externa TC % 70 % 40% 30% 50% 70% 50% 70% 50% 50%

20 Clasificar la Resistencia Resistencia a ALK % ALK resits mut. EGFR signaling Other KIT amplif ALK amplific Wang eta al, J Hematol Oncol 2016

21 Caso 3

22 El resultado GPS es un predictor independiente de patología adversa, metástasis y supervivencia a 10a. Intermediate GPS individualiza la estimación del riesgo NCCN Low Very Low Brand et al. Urology American Society of Clinical Oncology (ASCO) and ASCO are registered trademarks of ASCO; National Comprehensive Cancer Network (NCCN) and NCCN are registered trademarks of NCCN. ASCO and NCCN do not endorse any product or therapy.

23 Caso 4

24 Conclusiones: AP centrada en el paciente: que cada paciente tenga el mejor diagnóstico y tratamiento en cada momento. Caso 1 y 3 Caso 1 y 2 Caso 4 Test moleculares (reflejos y a demanda) INTEGRADOS. Gen a Gen +/_ Paneles genes Repetir test si hay nuevas muestras o tenemos distintos métodos (REDUNDANCIA) si: Muestra inicial pequeña (%tumor/sensibilidad técnica) Fuertes correlaciones clínico-morfológicas Respuesta al tratamiento anormal Biopsia Liquida y/o Rebiopsia a la progresión o resistencia Biomarcadores de inmunoterapia: PDL1 Carga de mutaciones, NGS.. Carga tumoral - monitorizar

25 Muchas gracias!!!